Have questions? Visit https://www.reddit.com/r/SNPedia

rs587780124

From SNPedia

ClinVar
Risk
Alt
Reference Rs587780124(GCAGCAGGCGGCTACTGCACAAGCT;GCAGCAGGCGGCTACTGCACAAGCT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome not provided
Variation info
Gene SMAD4
CLNDBN Hereditary cancer-predisposing syndrome not provided
Reversed 0
HGVS NC_000018.9:g.48603050_48603074del25
CLNSRC
CLNACC RCV000115881.4, RCV000235213.1,