Have questions? Visit https://www.reddit.com/r/SNPedia

rs587780668

From SNPedia

Orientationminus
Geno Mag Summary
(;) 0 common in clinvar
(-;GGCGGCGGGGAGCAGCATGGAGCC) 4 linked to certain hereditary cancers
Make rs587780668(-;-)
Make rs587780668(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
ReferenceGRCh38.p2 38.2/144
Chromosome9
Position21974795
GeneCDKN2A
is asnp
is mentioned by
dbSNPrs587780668
ClinGenrs587780668
ebirs587780668
HLIrs587780668
Exacrs587780668
Varsomers587780668
Maprs587780668
PheGenIrs587780668
hapmaprs587780668
1000 genomesrs587780668
hgdprs587780668
ensemblrs587780668
gopubmedrs587780668
geneviewrs587780668
scholarrs587780668
googlers587780668
pharmgkbrs587780668
gwascentralrs587780668
openSNPrs587780668
23andMers587780668
23andMe allrs587780668
SNP Nexus

SNPshotrs587780668
SNPdbers587780668
MSV3drs587780668
GWAS Ctlgrs587780668
Max Magnitude4
ClinVar
Risk rs587780668(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
Alt rs587780668(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
Reference Rs587780668(;)
Significance Pathogenic
Disease Hereditary cutaneous melanoma not provided Hereditary cancer-predisposing syndrome
Variation info
Gene CDKN2A
CLNDBN Hereditary cutaneous melanoma not provided Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000009.11:g.21974795_21974818dup24
CLNSRC
CLNACC RCV000122949.3, RCV000160401.2, RCV000163609.2,