rs587780668(-;GGCGGCGGGGAGCAGCATGGAGCC)
From SNPedia
| linked to certain hereditary cancers |
| Is a | genotype |
| of | rs587780668 |
| Gene | CDKN2A |
| Chromosome | 9 |
| Position | 21,974,795 |
| Merged from | Rs606231175 |
| mentioned | by |
| Magnitude | 4 |
| Repute | Bad |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 0 | common in clinvar |
| (-;GGCGGCGGGGAGCAGCATGGAGCC) | 4 | linked to certain hereditary cancers |
Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer [PMID 27978560]
