Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781240

From SNPedia

ClinVar
Risk rs587781240(CTCAAGCAAAGAAAAACTTAAA,CTTAAA;CTCAAGCAAAGAAAAACTTAAA,CTTAAA)
Alt rs587781240(CTCAAGCAAAGAAAAACTTAAA,CTTAAA;CTCAAGCAAAGAAAAACTTAAA,CTTAAA)
Reference rs587781240(A;A)
Significance Pathogenic
Disease Angelman syndrome
Variation info
Gene UBE3A
CLNDBN Angelman syndrome
Reversed 1
HGVS NC_000015.9:g.25584336_25584340dupTTAAG; NC_000015.9:g.25584336_25584356dup21
CLNSRC
CLNACC RCV000193223.1, RCV000144316.1,