Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781256

From SNPedia

ClinVar
Risk rs587781256(;)
Alt rs587781256(;)
Reference rs587781256(AAATTTTTTACTTTTAGTAAA;AAATTTTTTACTTTTAGTAAA)
Significance Pathogenic
Disease Retinoblastoma
Variation info
Gene RB1
CLNDBN Retinoblastoma
Reversed 0
HGVS NC_000013.10:g.48954232_48954252del21
CLNSRC
CLNACC RCV000128456.1,