Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781526

From SNPedia

ClinVar
Risk rs587781526(AATA;AATA)
Alt rs587781526(AATA;AATA)
Reference rs587781526(TCTATGATCTCTTTAGGGGT;TCTATGATCTCTTTAGGGGT)
Significance Probable-Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene BRCA1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41215387_41215406del20insTATT
CLNSRC
CLNACC RCV000129518.1,