Have questions? Visit https://www.reddit.com/r/SNPedia

rs587782540

From SNPedia

ClinVar
Risk rs587782540(;)
Alt rs587782540(;)
Reference rs587782540(GCAGCAGGCGGCTACTGCACAAGCT;GCAGCAGGCGGCTACTGCACAAGCT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome not provided
Variation info
Gene SMAD4
CLNDBN Hereditary cancer-predisposing syndrome not provided
Reversed 0
HGVS NC_000018.9:g.48603050_48603074del25
CLNSRC
CLNACC RCV000115881.4, RCV000235213.1,