Have questions? Visit https://www.reddit.com/r/SNPedia

rs587783198

From SNPedia

Orientationminus
Geno Mag Summary
(A;A) 0 common in clinvar
Make rs587783198(-;-)
Make rs587783198(-;GGC)
Make rs587783198(GGC;GGC)
ReferenceGRCh38.p2 38.2/147
ChromosomeX
Position25013659
GeneARX
is asnp
is mentioned by
dbSNPrs587783198
ebirs587783198
HLIrs587783198
Exacrs587783198
Varsomers587783198
Maprs587783198
PheGenIrs587783198
hapmaprs587783198
1000 genomesrs587783198
hgdprs587783198
ensemblrs587783198
gopubmedrs587783198
geneviewrs587783198
scholarrs587783198
googlers587783198
pharmgkbrs587783198
gwascentralrs587783198
openSNPrs587783198
23andMers587783198
23andMe allrs587783198
SNP Nexus

SNPshotrs587783198
SNPdbers587783198
MSV3drs587783198
GWAS Ctlgrs587783198
Max Magnitude0
ClinVar
Risk rs587783198(GGCGGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCA,GGCA;GGCGGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCA,GGCA)
Alt rs587783198(GGCGGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCA,GGCA;GGCGGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCGGCGGCGGCGGCA,GGCGGCGGCA,GGCA)
Reference rs587783198(A;A)
Significance Pathogenic
Disease not provided not specified Epileptic encephalopathy Mental retardation Lissencephaly 2
Variation info
Gene ARX
CLNDBN not provided not specified Epileptic encephalopathy, early infantile, 1 Mental retardation, with or without seizures, ARX-related, X-linked Lissencephaly 2, X-linked
Reversed 1
HGVS NC_000023.10:g.25031776_25031777insGCCGCCGCC; NC_000023.10:g.25031777_25031779dupGCC; NC_000023.10:g.25031777_25031797dup21; NC_000023.10:g.25031777_25031800dup24
CLNSRC
CLNACC RCV000175970.1, RCV000145054.3, RCV000231610.1, RCV000193540.1, RCV000192640.1,