Have questions? Visit https://www.reddit.com/r/SNPedia

rs587783199

From SNPedia

ClinVar
Risk rs587783199(;)
Alt rs587783199(;)
Reference rs587783199(CAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG;CAGCGGCCGCCACGGCCACGGCGGGTCCACGCGG)
Significance Pathogenic
Disease Lissencephaly 2
Variation info
Gene ARX
CLNDBN Lissencephaly 2, X-linked
Reversed 1
HGVS NC_000023.10:g.25031744_25031777del34
CLNSRC
CLNACC RCV000145055.1,