Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231175

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common/normal
(-;GGCGGCGGGGAGCAGCATGGAGCC) 5 Malignant melanoma predisposing mutation
Make rs606231175(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
ReferenceGRCh38.p2 38.2/147
Chromosome9
Position21974819
GeneCDKN2A
is asnp
is mentioned by
dbSNPrs606231175
ebirs606231175
HLIrs606231175
Exacrs606231175
Varsomers606231175
Maprs606231175
PheGenIrs606231175
hapmaprs606231175
1000 genomesrs606231175
hgdprs606231175
ensemblrs606231175
gopubmedrs606231175
geneviewrs606231175
scholarrs606231175
googlers606231175
pharmgkbrs606231175
gwascentralrs606231175
openSNPrs606231175
23andMers606231175
23andMe allrs606231175
SNP Nexus

SNPshotrs606231175
SNPdbers606231175
MSV3drs606231175
GWAS Ctlgrs606231175
Max Magnitude5
rs606231175, also known as c.-16_8dup24, represents a rare mutation in the CDKN2A gene on chromosome 9.

The rs606231175(dup24) allele is considered pathogenic in a dominant manner for malignant melanoma, based on sources in ClinVar and elsewhere. CDKN2A mutations may also predispose to other types of cancer.[PMID 12072543OA-icon.png],[PMID 16234564OA-icon.png]

ClinVar
Risk rs606231175(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
Alt rs606231175(GGCGGCGGGGAGCAGCATGGAGCC;GGCGGCGGGGAGCAGCATGGAGCC)
Reference rs606231175(;)
Significance Other
Disease Melanoma
Variation info
Gene CDKN2A
CLNDBN Melanoma, cutaneous malignant, susceptibility to, 2
Reversed 1
HGVS NC_000009.11:g.21974819_21974842dup24
CLNSRC OMIM Allelic Variant
CLNACC RCV000010023.2,