Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231175(-;-)

From SNPedia

common/normal
Is agenotype
ofrs606231175
GeneCDKN2A
Chromosome9
Position21,974,819
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;-) 0 common/normal
(-;GGCGGCGGGGAGCAGCATGGAGCC) 5 Malignant melanoma predisposing mutation