Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231187

From SNPedia

ClinVar
Risk
Alt
Reference Rs606231187(CTGAGCCACCTTTGGAAGAG;CTGAGCCACCTTTGGAAGAG)
Significance Pathogenic
Disease Pyruvate dehydrogenase E1-alpha deficiency
Variation info
Gene PDHA1 MAP3K15
CLNDBN Pyruvate dehydrogenase E1-alpha deficiency
Reversed 0
HGVS NC_000023.10:g.19377671_19377690del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000011623.11,