Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231198

From SNPedia

ClinVar
Risk
Alt
Reference Rs606231198(CCCTGTCCGACTTGTCATGGC;CCCTGTCCGACTTGTCATGGC)
Significance Pathogenic
Disease Renpenning syndrome 1 not specified
Variation info
Gene PQBP1
CLNDBN Renpenning syndrome 1 not specified
Reversed 1
HGVS NC_000023.10:g.48759551_48759571del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000011731.3, RCV000153765.3,