Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231293

From SNPedia

ClinVar
Risk rs606231293(CGGAAAATACAGTCTCAGTTCACCGATGCC;CGGAAAATACAGTCTCAGTTCACCGATGCC)
Alt rs606231293(CGGAAAATACAGTCTCAGTTCACCGATGCC;CGGAAAATACAGTCTCAGTTCACCGATGCC)
Reference rs606231293(;)
Significance Pathogenic
Disease Cardiomyopathy
Variation info
Gene DSP
CLNDBN Cardiomyopathy, dilated, with woolly hair, keratoderma, and tooth agenesis
Reversed 0
HGVS NC_000006.11:g.7571731_7571760dup30
CLNSRC OMIM Allelic Variant
CLNACC RCV000144959.2,