Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231365

From SNPedia

ClinVar
Risk rs606231365(AAAATTCAAACTTCAGAAAT;AAAATTCAAACTTCAGAAAT)
Alt rs606231365(AAAATTCAAACTTCAGAAAT;AAAATTCAAACTTCAGAAAT)
Reference rs606231365(;)
Significance Pathogenic
Disease Autoimmune lymphoproliferative syndrome
Variation info
Gene FAS
CLNDBN Autoimmune lymphoproliferative syndrome, type 1a
Reversed 0
HGVS NC_000010.10:g.90774167_90774186dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000017973.30,