Have questions? Visit https://www.reddit.com/r/SNPedia

rs61754419

From SNPedia

ClinVar
Risk rs61754419(;)
Alt rs61754419(;)
Reference rs61754419(TGCCCCCACCTCCACCTGAGCCCGAGAGCTC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296092_153296122del31
CLNSRC
CLNACC RCV000132891.2,