Have questions? Visit https://www.reddit.com/r/SNPedia

rs62895363

From SNPedia

Orientationminus
Geno Mag Summary
(-;23) 3 Carrier of a phenylketonuria mutation
(TCCTTGTATAAAACCCATGCTTG;TCCTTGTATAAAACCCATGCTTG) 0 common in clinvar
Make rs62895363(-;-)
Make rs62895363(-;TCCTTGTATAAAACCCATGCTTG)
ReferenceGRCh38.p2 38.2/147
Chromosome12
Position102855234
GenePAH
is asnp
is mentioned by
dbSNPrs62895363
ebirs62895363
HLIrs62895363
Exacrs62895363
Varsomers62895363
Maprs62895363
PheGenIrs62895363
hapmaprs62895363
1000 genomesrs62895363
hgdprs62895363
ensemblrs62895363
gopubmedrs62895363
geneviewrs62895363
scholarrs62895363
googlers62895363
pharmgkbrs62895363
gwascentralrs62895363
openSNPrs62895363
23andMers62895363
23andMe allrs62895363
SNP Nexus

SNPshotrs62895363
SNPdbers62895363
MSV3drs62895363
GWAS Ctlgrs62895363
Max Magnitude3
ClinVar
Risk rs62895363(;)
Alt rs62895363(;)
Reference rs62895363(TCCTTGTATAAAACCCATGCTTG;TCCTTGTATAAAACCCATGCTTG)
Significance Untested
Disease not provided
Variation info
Gene PAH
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.103249012_103249034del23
CLNSRC
CLNACC RCV000088992.1,