Have questions? Visit https://www.reddit.com/r/SNPedia

rs63083561

From SNPedia

Orientationminus
Geno Mag Summary
(-;23) 3 Carrier of a phenylketonuria mutation
(TGTATAAAACCCATGCTTGCTAT;TGTATAAAACCCATGCTTGCTAT) 0 common in clinvar
Make rs63083561(-;-)
Make rs63083561(-;TGTATAAAACCCATGCTTGCTAT)
ReferenceGRCh38.p2 38.2/147
Chromosome12
Position102855230
GenePAH
is asnp
is mentioned by
dbSNPrs63083561
ebirs63083561
HLIrs63083561
Exacrs63083561
Varsomers63083561
Maprs63083561
PheGenIrs63083561
hapmaprs63083561
1000 genomesrs63083561
hgdprs63083561
ensemblrs63083561
gopubmedrs63083561
geneviewrs63083561
scholarrs63083561
googlers63083561
pharmgkbrs63083561
gwascentralrs63083561
openSNPrs63083561
23andMers63083561
23andMe allrs63083561
SNP Nexus

SNPshotrs63083561
SNPdbers63083561
MSV3drs63083561
GWAS Ctlgrs63083561
Max Magnitude3
ClinVar
Risk rs63083561(;)
Alt rs63083561(;)
Reference rs63083561(TGTATAAAACCCATGCTTGCTAT;TGTATAAAACCCATGCTTGCTAT)
Significance Untested
Disease not provided
Variation info
Gene PAH
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.103249008_103249030del23
CLNSRC
CLNACC RCV000088994.1,