Have questions? Visit https://www.reddit.com/r/SNPedia

rs63083561(TGTATAAAACCCATGCTTGCTAT;TGTATAAAACCCATGCTTGCTAT)

From SNPedia

common in clinvar
Is agenotype
ofrs63083561
GenePAH
Chromosome12
Position102,855,230
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;23) 3 Carrier of a phenylketonuria mutation
(TGTATAAAACCCATGCTTGCTAT;TGTATAAAACCCATGCTTGCTAT) 0 common in clinvar