Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749029

From SNPedia

ClinVar
Risk rs63749029(;)
Alt rs63749029(;)
Reference rs63749029(GCCCCCACCTCCACCTGAGCCCGAGAGCT;GCCCCCACCTCCACCTGAGCCCGAGAGCT)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296093_153296121del29
CLNSRC
CLNACC RCV000132899.2,