Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749676

From SNPedia

Orientationminus
Geno Mag Summary
(-;22) 3 Carrier of a phenylketonuria mutation
(ATAAAACCCATGCTTGCTATGA;ATAAAACCCATGCTTGCTATGA) 0 common in clinvar
Make rs63749676(-;-)
Make rs63749676(-;ATAAAACCCATGCTTGCTATGA)
ReferenceGRCh38.p2 38.2/147
Chromosome12
Position102855228
GenePAH
is asnp
is mentioned by
dbSNPrs63749676
ebirs63749676
HLIrs63749676
Exacrs63749676
Varsomers63749676
Maprs63749676
PheGenIrs63749676
hapmaprs63749676
1000 genomesrs63749676
hgdprs63749676
ensemblrs63749676
gopubmedrs63749676
geneviewrs63749676
scholarrs63749676
googlers63749676
pharmgkbrs63749676
gwascentralrs63749676
openSNPrs63749676
23andMers63749676
23andMe allrs63749676
SNP Nexus

SNPshotrs63749676
SNPdbers63749676
MSV3drs63749676
GWAS Ctlgrs63749676
Max Magnitude3
ClinVar
Risk rs63749676(;)
Alt rs63749676(;)
Reference rs63749676(ATAAAACCCATGCTTGCTATGA;ATAAAACCCATGCTTGCTATGA)
Significance Untested
Disease not provided
Variation info
Gene PAH
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.103249006_103249027del22
CLNSRC
CLNACC RCV000088996.1,