Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749676(ATAAAACCCATGCTTGCTATGA;ATAAAACCCATGCTTGCTATGA)

From SNPedia

common in clinvar
Is agenotype
ofrs63749676
GenePAH
Chromosome12
Position102,855,228
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;22) 3 Carrier of a phenylketonuria mutation
(ATAAAACCCATGCTTGCTATGA;ATAAAACCCATGCTTGCTATGA) 0 common in clinvar