Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749749

From SNPedia

ClinVar
Risk rs63749749(;)
Alt rs63749749(;)
Reference rs63749749(ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC;ACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC)
Significance Pathogenic
Disease not provided not specified Autism Severe neonatal-onset encephalopathy with microcephaly Mental retardation Rett syndrome
Variation info
Gene MECP2
CLNDBN not provided not specified Autism, susceptibility to, X-linked 3 Severe neonatal-onset encephalopathy with microcephaly Mental retardation, X-linked, syndromic 13 Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296072_153296115del44
CLNSRC ClinVar GeneDx
CLNACC RCV000132932.4, RCV000168704.1, RCV000169931.1, RCV000169932.1, RCV000170102.1, RCV000170103.4,