Have questions? Visit https://www.reddit.com/r/SNPedia

rs63750122

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(TCTGCCCAGGTTAAGGGCCACGGC;TCTGCCCAGGTTAAGGGCCACGGC) 0 common in complete genomics
Make rs63750122(-;-)
Make rs63750122(-;TCTGCCCAGGTTAAGGGCCACGGC)
ReferenceGRCh38 38.1/141
Chromosome16
Position176990
GeneHBA1
is asnp
is mentioned by
dbSNPrs63750122
ebirs63750122
HLIrs63750122
Exacrs63750122
Varsomers63750122
Maprs63750122
PheGenIrs63750122
hapmaprs63750122
1000 genomesrs63750122
hgdprs63750122
ensemblrs63750122
gopubmedrs63750122
geneviewrs63750122
scholarrs63750122
googlers63750122
pharmgkbrs63750122
gwascentralrs63750122
openSNPrs63750122
23andMers63750122
23andMe allrs63750122
SNP Nexus

SNPshotrs63750122
SNPdbers63750122
MSV3drs63750122
GWAS Ctlgrs63750122
Max Magnitude0
OMIM141800
Desc
Variant0199
Relatedalso


ClinVar
Risk rs63750122(;)
Alt rs63750122(;)
Reference rs63750122(GCCACGGCTCTGCCCAGGTTAAGG;GCCACGGCTCTGCCCAGGTTAAGG)
Significance Other
Disease HEMOGLOBIN J (BISKRA)
Variation info
Gene HBA1
CLNDBN HEMOGLOBIN J (BISKRA)
Reversed 0
HGVS NC_000016.9:g.226989_227012del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000017218.2,