Have questions? Visit https://www.reddit.com/r/SNPedia

rs63750223

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GC;GC) 0 common in clinvar
(GGTCTATTTTCCCACCCTTAGGCTG;GGTCTATTTTCCCACCCTTAGGCTG) 0 common in clinvar
(I;I) 0
Make rs63750223(-;-)
Make rs63750223(-;GGTCTATTTTCCCACCCTTAGGCTG)
ReferenceGRCh38 38.1/141
Chromosome11
Position5226796
GeneHBB
is asnp
is mentioned by
dbSNPrs63750223
ebirs63750223
HLIrs63750223
Exacrs63750223
Varsomers63750223
Maprs63750223
PheGenIrs63750223
hapmaprs63750223
1000 genomesrs63750223
hgdprs63750223
ensemblrs63750223
gopubmedrs63750223
geneviewrs63750223
scholarrs63750223
googlers63750223
pharmgkbrs63750223
gwascentralrs63750223
openSNPrs63750223
23andMers63750223
23andMe allrs63750223
SNP Nexus

SNPshotrs63750223
SNPdbers63750223
MSV3drs63750223
GWAS Ctlgrs63750223
Max Magnitude0
OMIM141900
Desc
Variant0352
Relatedalso


ClinVar
Risk rs63750223(GGTCTATTTTCCCACCCTTAGGCTGC,C;GGTCTATTTTCCCACCCTTAGGCTGC,C)
Alt rs63750223(GGTCTATTTTCCCACCCTTAGGCTGC,C;GGTCTATTTTCCCACCCTTAGGCTGC,C)
Reference rs63750223(GGTCTATTTTCCCACCCTTAGGCTG;GGTCTATTTTCCCACCCTTAGGCTG)
Significance Pathogenic
Disease beta0^ Thalassemia beta Thalassemia
Variation info
Gene HBB
CLNDBN beta0^ Thalassemia beta Thalassemia
Reversed 1
HGVS NC_000011.9:g.5248026_5248050del25
CLNSRC HBVAR OMIM Allelic Variant
CLNACC RCV000016700.24, RCV000030009.1,



[PMID 6190800] Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia.