Have questions? Visit https://www.reddit.com/r/SNPedia

rs63751076

From SNPedia

OMIM141900
Desc
Variant0355
Relatedalso
ClinVar
Risk rs63751076(GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTT,T;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTT,T)
Alt rs63751076(GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTT,T;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTT,T)
Reference rs63751076(GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT)
Significance Pathogenic
Disease beta^0^ Thalassemia
Variation info
Gene HBB
CLNDBN beta^0^ Thalassemia
Reversed 1
HGVS NC_000011.9:g.5248133_5248176del44
CLNSRC HBVAR OMIM Allelic Variant
CLNACC RCV000016703.23,


[PMID 2753736] Characterization of three types of beta zero-thalassemia resulting from a partial deletion of the beta-globin gene.