Have questions? Visit https://www.reddit.com/r/SNPedia

rs66698963

From SNPedia

http://www.eurekalert.org/pub_releases/2016-03/mbae-aww032416.php

and http://mbe.oxfordjournals.org/content/early/2016/03/09/molbev.msw049.abstract if they stray from a balanced omega-6 to omega-3 diet -- may make people more susceptible to inflammation, and by association, increased risk of heart disease and colon cancer.

ClinVar
Risk rs66698963(;)
Alt rs66698963(;)
Reference rs66698963(CTCCCTGCCTCCCCAGGGACTT;CTCCCTGCCTCCCCAGGGACTT)
Significance Untested
Disease not provided
Variation info
Gene FADS2
CLNDBN not provided
Reversed 0
HGVS NC_000011.9:g.61602537_61602558del22
CLNSRC
CLNACC RCV000149463.1,