Have questions? Visit https://www.reddit.com/r/SNPedia

rs672601357

From SNPedia

ClinVar
Risk rs672601357(GCGCT;GCGCT)
Alt rs672601357(GCGCT;GCGCT)
Reference rs672601357(AAGCCGGACCCGGCGCAGAAGCCCCCGTACTC;AAGCCGGACCCGGCGCAGAAGCCCCCGTACTC)
Significance Pathogenic
Disease Blepharophimosis
Variation info
Gene FOXL2 C3orf72 FOXL2NB
CLNDBN Blepharophimosis, ptosis, and epicanthus inversus
Reversed 1
HGVS NC_000003.11:g.138665392_138665423del32insAGCGC
CLNSRC
CLNACC RCV000149460.1,