Have questions? Visit https://www.reddit.com/r/SNPedia

rs727502780

From SNPedia

ClinVar
Risk
Alt
Reference Rs727502780(GGCAACTACAGCAGCAGCAGCAGC;GGCAACTACAGCAGCAGCAGCAGC)
Significance Pathogenic
Disease Prostate cancer
Variation info
Gene LOC101927978 ZFHX3
CLNDBN Prostate cancer, somatic
Reversed 1
HGVS NC_000016.9:g.72822010_72822033del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000019797.28,