Have questions? Visit https://www.reddit.com/r/SNPedia

rs727502975

From SNPedia

ClinVar
Risk rs727502975(;)
Alt rs727502975(;)
Reference rs727502975(TGGAGCGCGGGGGCGGCGCTG;TGGAGCGCGGGGGCGGCGCTG)
Significance Probable-Pathogenic
Disease Primary ciliary dyskinesia
Variation info
Gene DNAH5
CLNDBN Primary ciliary dyskinesia
Reversed 1
HGVS NC_000005.9:g.13810289_13810309del21
CLNSRC
CLNACC RCV000150472.1,