Have questions? Visit https://www.reddit.com/r/SNPedia

rs727503014

From SNPedia

ClinVar
Risk rs727503014(GTCAA;GTCAA)
Alt rs727503014(GTCAA;GTCAA)
Reference rs727503014(ATCAAGGAATTAAGAGAAGC;ATCAAGGAATTAAGAGAAGC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242460_55242479delinsGTCAA
CLNSRC
CLNACC RCV000150616.1,