Have questions? Visit https://www.reddit.com/r/SNPedia

rs727503187

From SNPedia

ClinVar
Risk rs727503187(;)
Alt rs727503187(;)
Reference rs727503187(CGTGGTGTACGAGATGCGCGTC;CGTGGTGTACGAGATGCGCGTC)
Significance Pathogenic
Disease Primary familial hypertrophic cardiomyopathy
Variation info
Gene MYBPC3
CLNDBN Primary familial hypertrophic cardiomyopathy
Reversed 1
HGVS NC_000011.9:g.47359006_47359027del22
CLNSRC
CLNACC RCV000151093.1,