Have questions? Visit https://www.reddit.com/r/SNPedia

rs727503744

From SNPedia

ClinVar
Risk rs727503744(;)
Alt rs727503744(;)
Reference rs727503744(GCGCGCACGCAGCTCCGCCCC;GCGCGCACGCAGCTCCGCCCC)
Significance Probable-Pathogenic
Disease Von Hippel-Lindau syndrome
Variation info
Gene VHL
CLNDBN Von Hippel-Lindau syndrome
Reversed 0
HGVS NC_000003.11:g.10183457_10183477del21
CLNSRC
CLNACC RCV000152657.1,