Have questions? Visit https://www.reddit.com/r/SNPedia

rs727503992

From SNPedia

ClinVar
Risk
Alt
Reference Rs727503992(CCAAGGGCATTGTTTTTCAACAT;CCAAGGGCATTGTTTTTCAACAT)
Significance Pathogenic
Disease not provided
Variation info
Gene LAMA2
CLNDBN not provided
Reversed 0
HGVS NC_000006.11:g.129636688_129636710delAGGGCATTGTTTTTCAACATCCA
CLNSRC
CLNACC RCV000153435.2,