Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504232

From SNPedia

ClinVar
Risk rs727504232(;)
Alt rs727504232(;)
Reference rs727504232(ATCTCCGAAAGCCAACAAGGAAAT;ATCTCCGAAAGCCAACAAGGAAAT)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242483_55242506del24
CLNSRC
CLNACC RCV000154196.1,