Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504282

From SNPedia

ClinVar
Risk rs727504282(TCT;TCT)
Alt rs727504282(TCT;TCT)
Reference rs727504282(AATTAAGAGAAGCAACATCTC;AATTAAGAGAAGCAACATCTC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242467_55242487delinsTCT
CLNSRC
CLNACC RCV000154290.1,