Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504339

From SNPedia

ClinVar
Risk rs727504339(AA,ACAAT;AA,ACAAT)
Alt rs727504339(AA,ACAAT;AA,ACAAT)
Reference rs727504339(ATTAAGAGAAGCAACATCTC;ATTAAGAGAAGCAACATCTC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242469_55242487delinsA; NC_000007.13:g.55242469_55242487delinsCAAT
CLNSRC
CLNACC RCV000154456.1, RCV000154485.1,