Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504395

From SNPedia

ClinVar
Risk rs727504395(GAT;GAT)
Alt rs727504395(GAT;GAT)
Reference rs727504395(ACATCTCCGAAAGCCAACAAGGAAATC;ACATCTCCGAAAGCCAACAAGGAAATC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242481_55242507delinsGAT
CLNSRC
CLNACC RCV000154566.1,