Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504414

From SNPedia

ClinVar
Risk rs727504414(ACGAGAGA;ACGAGAGA)
Alt rs727504414(ACGAGAGA;ACGAGAGA)
Reference rs727504414(TTAAGAGAAGCAACATCTCCGAAAGC;TTAAGAGAAGCAACATCTCCGAAAGC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242469_55242494delinsACGAGAGA
CLNSRC
CLNACC RCV000154604.1,