Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504428

From SNPedia

ClinVar
Risk rs727504428(AAAGTT;AAAGTT)
Alt rs727504428(AAAGTT;AAAGTT)
Reference rs727504428(CAAGGAATTAAGAGAAGCAAC;CAAGGAATTAAGAGAAGCAAC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242462_55242482delinsAAAGTT
CLNSRC
CLNACC RCV000154644.1,