Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504825

From SNPedia

ClinVar
Risk rs727504825(;)
Alt rs727504825(;)
Reference rs727504825(TGTTGGTGAACCAGTTCAGG;TGTTGGTGAACCAGTTCAGG)
Significance Probable-Pathogenic
Disease Primary dilated cardiomyopathy
Variation info
Gene TTN TTN-AS1
CLNDBN Primary dilated cardiomyopathy
Reversed 1
HGVS NC_000002.11:g.179478809_179478828del20
CLNSRC
CLNACC RCV000156164.1,