Have questions? Visit https://www.reddit.com/r/SNPedia

rs727505015

From SNPedia

ClinVar
Risk rs727505015(ATCCTACATACTTAAAATTTCTT;ATCCTACATACTTAAAATTTCTT)
Alt rs727505015(ATCCTACATACTTAAAATTTCTT;ATCCTACATACTTAAAATTTCTT)
Reference rs727505015(TGCTGG;TGCTGG)
Significance Probable-Pathogenic
Disease Non-syndromic genetic deafness
Variation info
Gene MYO6
CLNDBN Non-syndromic genetic deafness
Reversed 0
HGVS NC_000006.11:g.76617352_76617357delinsATCCTACATACTTAAAATTTCTT
CLNSRC
CLNACC RCV000156438.1,