Have questions? Visit https://www.reddit.com/r/SNPedia

rs730880264

From SNPedia

ClinVar
Risk rs730880264(GGGCTAAAAGTACTGTTGGGG;GGGCTAAAAGTACTGTTGGGG)
Alt rs730880264(GGGCTAAAAGTACTGTTGGGG;GGGCTAAAAGTACTGTTGGGG)
Reference rs730880264(CCC;CCC)
Significance Pathogenic
Disease Sjögren-Larsson syndrome
Variation info
Gene ALDH3A2
CLNDBN Sjögren-Larsson syndrome
Reversed 0
HGVS NC_000017.10:g.19566646_19566648delCCCinsGGGCTAAAAGTACTGTTGGGG
CLNSRC OMIM Allelic Variant
CLNACC RCV000001705.3,