Have questions? Visit https://www.reddit.com/r/SNPedia

rs730880277

From SNPedia

ClinVar
Risk rs730880277(;)
Alt rs730880277(;)
Reference rs730880277(TTCCGGGATTAGCGAACTTCCAG;TTCCGGGATTAGCGAACTTCCAG)
Significance Pathogenic
Disease Fanconi anemia
Variation info
Gene FANCF
CLNDBN Fanconi anemia, complementation group F
Reversed 1
HGVS NC_000011.9:g.22647105_22647127del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006712.3,