Have questions? Visit https://www.reddit.com/r/SNPedia

rs730881840

From SNPedia

ClinVar
Risk
Alt
Reference Rs730881840(TGAAAATGATCAGTCGATCAGCCGAAATCAT;TGAAAATGATCAGTCGATCAGCCGAAATCAT)
Significance Pathogenic
Disease not provided
Variation info
Gene NBN
CLNDBN not provided
Reversed 1
HGVS NC_000008.10:g.90994986_90995016del31
CLNSRC
CLNACC RCV000160767.2,