Have questions? Visit https://www.reddit.com/r/SNPedia

rs730882149

From SNPedia

ClinVar
Risk rs730882149(AGTGTGCCTCCAGTGCCTCGCTCCA;AGTGTGCCTCCAGTGCCTCGCTCCA)
Alt rs730882149(AGTGTGCCTCCAGTGCCTCGCTCCA;AGTGTGCCTCCAGTGCCTCGCTCCA)
Reference rs730882149(GC;GC)
Significance Pathogenic
Disease Retinitis pigmentosa 37
Variation info
Gene NR2E3
CLNDBN Retinitis pigmentosa 37
Reversed 0
HGVS NC_000015.9:g.72103847_72103848delGCinsAGTGTGCCTCCAGTGCCTCGCTCCA
CLNSRC OMIM Allelic Variant
CLNACC RCV000162027.3,