Have questions? Visit https://www.reddit.com/r/SNPedia

rs74315128

From SNPedia

ClinVar
Risk rs74315128(;)
Alt rs74315128(;)
Reference rs74315128(CCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCA;CCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCA)
Significance Untested
Disease
Variation info
Gene ABCC6
CLNDBN
Reversed 1
HGVS NC_000016.9:g.16251534_16251581del48
CLNSRC
CLNACC


[PMID 15727254] Efficient molecular diagnostic strategy for ABCC6 in pseudoxanthoma elasticum.