Have questions? Visit https://www.reddit.com/r/SNPedia

rs74315139

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CTACGGCAAGAAGGGAGCCAGTGGC;CTACGGCAAGAAGGGAGCCAGTGGC) 0 common in clinvar
Make rs74315139(-;-)
Make rs74315139(-;CTACGGCAAGAAGGGAGCCAGTGGC)
ReferenceGRCh38 38.1/141
Chromosome16
Position16203519
GeneABCC6
is asnp
is mentioned by
dbSNPrs74315139
ebirs74315139
HLIrs74315139
Exacrs74315139
Varsomers74315139
Maprs74315139
PheGenIrs74315139
hapmaprs74315139
1000 genomesrs74315139
hgdprs74315139
ensemblrs74315139
gopubmedrs74315139
geneviewrs74315139
scholarrs74315139
googlers74315139
pharmgkbrs74315139
gwascentralrs74315139
openSNPrs74315139
23andMers74315139
23andMe allrs74315139
SNP Nexus

SNPshotrs74315139
SNPdbers74315139
MSV3drs74315139
GWAS Ctlgrs74315139
Max Magnitude0
ClinVar
Risk rs74315139(;)
Alt rs74315139(;)
Reference rs74315139(CTACGGCAAGAAGGGAGCCAGTGGC;CTACGGCAAGAAGGGAGCCAGTGGC)
Significance Untested
Disease
Variation info
Gene ABCC6
CLNDBN
Reversed 1
HGVS NC_000016.9:g.16297376_16297400del25
CLNSRC
CLNACC


[PMID 12384774] Evidence for a founder effect for pseudoxanthoma elasticum in the Afrikaner population of South Africa.