Have questions? Visit https://www.reddit.com/r/SNPedia

rs74315156

From SNPedia

ClinVar
Risk rs74315156(;)
Alt rs74315156(;)
Reference rs74315156(AAACGCTGTTTGAGCAGCAGAACATGTACAGGC;AAACGCTGTTTGAGCAGCAGAACATGTACAGGC)
Significance Untested
Disease
Variation info
Gene ABCC6
CLNDBN
Reversed 1
HGVS NC_000016.9:g.16295914_16295946del33
CLNSRC
CLNACC


[PMID 15086542] Novel ABCC6 mutations in pseudoxanthoma elasticum.