Have questions? Visit https://www.reddit.com/r/SNPedia

rs74315158

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AATAAACCTCACGGTGCCCCAG;AATAAACCTCACGGTGCCCCAG) 0 common in clinvar
Make rs74315158(-;-)
Make rs74315158(-;AATAAACCTCACGGTGCCCCAG)
ReferenceGRCh38 38.1/141
Chromosome16
Position16182909
GeneABCC6
is asnp
is mentioned by
dbSNPrs74315158
ebirs74315158
HLIrs74315158
Exacrs74315158
Varsomers74315158
Maprs74315158
PheGenIrs74315158
hapmaprs74315158
1000 genomesrs74315158
hgdprs74315158
ensemblrs74315158
gopubmedrs74315158
geneviewrs74315158
scholarrs74315158
googlers74315158
pharmgkbrs74315158
gwascentralrs74315158
openSNPrs74315158
23andMers74315158
23andMe allrs74315158
SNP Nexus

SNPshotrs74315158
SNPdbers74315158
MSV3drs74315158
GWAS Ctlgrs74315158
Max Magnitude0
ClinVar
Risk rs74315158(;)
Alt rs74315158(;)
Reference rs74315158(AATAAACCTCACGGTGCCCCAG;AATAAACCTCACGGTGCCCCAG)
Significance Untested
Disease
Variation info
Gene ABCC6
CLNDBN
Reversed 1
HGVS NC_000016.9:g.16276766_16276787del22
CLNSRC
CLNACC



[PMID 12673275] ABCC6/MRP6 mutations: further insight into the molecular pathology of pseudoxanthoma elasticum.